In the club flick
Claudia Burson is in between Johnnie Pena and Richard Waters
Pete
We now know what love is!
We now know what love is!
Thursday, January 17, 2008
Alonzo Peters, jaxtr
Just fer ya
Free calls international and no ID for those you do not want to call back
www.youtube.com/watch?v=nRHe7BMms0k&feature=related
jaxtr.com
Free calls international and no ID for those you do not want to call back
www.youtube.com/watch?v=nRHe7BMms0k&feature=related
jaxtr.com
Monday, January 14, 2008
First Sunday
After seeing the movie First Sunday, crying-laughing I realize that as he did before, Ice Cube has managed to pull off and pull out another winner. This movie will undoubtedly influence our consideration of attendance at church meetings. This movie will definitely Touch YOU.
It fooled me, feeding my consipiracy theories yet coming out with the truth that a theft is always an "inside job". He took the weight off of the pastors.
I went to a predominantly biker hip-hop gathering finding joy in seeing others in revelry only to have a rather buxom sister ask "RU a deacon? We also played with the " I got papers to prove it!"
I am sure that Ice Cube has captured the sentiment of many who have considered coming to church and some who don't while ending in a solution. This is for all accusers of the the community and for all active church members a necessity-FORGIVENESS. The solution is in the church's initiation of this spiritual principle.
He accurately looks at a major problem that is making the Black church and any business or institution impotent . This centers around a lack of knowledge or unwillingness to coordinate ALL of the existing community resources within the domain of the 'visionaries dream'. This allows for minimization of facism, waste and nepotism. Otherwise the church is not doing any different from an exclusive social club, giving the Good News and access to the pastor to a differentiated few that he has respector of persons for. The world that God despises is in, God is out, as is His hope for our communities, unless we correct this problem. All "members" of the body should have a function within the body of Christ and if not impotence will continue.
Does the leadership have anyone to answer to in these last days? Have not the majority of all of the current members "joined church" under his/her leadership? I assume a percentage of what they give "belongs" to him. As a worldly right to worldly passage without any inkling of spiritual development, servititude people line up to become members of the leadership so they can get in.No where is the Spirtual gift of prophecy allowed to question the leadership
It fooled me, feeding my consipiracy theories yet coming out with the truth that a theft is always an "inside job". He took the weight off of the pastors.
I went to a predominantly biker hip-hop gathering finding joy in seeing others in revelry only to have a rather buxom sister ask "RU a deacon? We also played with the " I got papers to prove it!"
I am sure that Ice Cube has captured the sentiment of many who have considered coming to church and some who don't while ending in a solution. This is for all accusers of the the community and for all active church members a necessity-FORGIVENESS. The solution is in the church's initiation of this spiritual principle.
He accurately looks at a major problem that is making the Black church and any business or institution impotent . This centers around a lack of knowledge or unwillingness to coordinate ALL of the existing community resources within the domain of the 'visionaries dream'. This allows for minimization of facism, waste and nepotism. Otherwise the church is not doing any different from an exclusive social club, giving the Good News and access to the pastor to a differentiated few that he has respector of persons for. The world that God despises is in, God is out, as is His hope for our communities, unless we correct this problem. All "members" of the body should have a function within the body of Christ and if not impotence will continue.
Does the leadership have anyone to answer to in these last days? Have not the majority of all of the current members "joined church" under his/her leadership? I assume a percentage of what they give "belongs" to him. As a worldly right to worldly passage without any inkling of spiritual development, servititude people line up to become members of the leadership so they can get in.No where is the Spirtual gift of prophecy allowed to question the leadership
Wednesday, January 9, 2008
video to photo
I spent all day making efforts to import from my DVD some video. Is this possible?
I had some stange file that it was recorded to.
Anyway I did bring one picture which is a BUNCH of pictures. See if you recognize anyone.
I had some stange file that it was recorded to.
Anyway I did bring one picture which is a BUNCH of pictures. See if you recognize anyone.
Sunday, January 6, 2008
Typical Justification and who does it (Stanford)
Biomedical Informatics
Translational Bioinformatics
It is the responsibility of those of us involved in today's biomedical research enterprise to translate the remarkable scientific innovations we are witnessing into health gains for the nation… At no other time has the need for a robust, bidirectional information flow between basic and translational scientists been so necessary.
Elias A. Zerhouni, M.D.,
Director, National Institutes of Health
New England Journal of Medicine, 353:1621, 2005
Translational Bioinformatics is the development of analytic, storage, and interpretive methods to optimize the transformation of increasingly voluminous genetic, genomic, and biological data into diagnostics and therapeutics for medicine. Topics covered in this course:
Access and utility of publicly available data sources
Types of genome-scale measurements in molecular biology and genomic medicine
Analysis of microarray data
Analysis of polymorphisms, proteomics, and protein interactions
Linking genome-scale data to clinical data and phenotypes
New questions in biomedicine using bioinformatics. Case studies.
Translational Bioinformatics
It is the responsibility of those of us involved in today's biomedical research enterprise to translate the remarkable scientific innovations we are witnessing into health gains for the nation… At no other time has the need for a robust, bidirectional information flow between basic and translational scientists been so necessary.
Elias A. Zerhouni, M.D.,
Director, National Institutes of Health
New England Journal of Medicine, 353:1621, 2005
Translational Bioinformatics is the development of analytic, storage, and interpretive methods to optimize the transformation of increasingly voluminous genetic, genomic, and biological data into diagnostics and therapeutics for medicine. Topics covered in this course:
Access and utility of publicly available data sources
Types of genome-scale measurements in molecular biology and genomic medicine
Analysis of microarray data
Analysis of polymorphisms, proteomics, and protein interactions
Linking genome-scale data to clinical data and phenotypes
New questions in biomedicine using bioinformatics. Case studies.
Alonzo Peters creator of Cytokine Dialectic Relationships as they relate to AK search in Misc.
Initiator
Prod / Activ Increase
Prod / Activ Decrease
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
TGF-Beta
TNF
J Imm/140/2312
Espevik/87
reciprocal activation/regulation LAK activity
TNF
J Imm/140/2312
Espevik/87
reciprocal activation/regulation LAK activity
VIP
Fed Proc/37/657
Giachetti/78
Leidi/Robbins/88Endocrine/122/1652,Meigan G/88,Endocrine/123/1098,Fernande,89,Endocrine/125/1991,Sasaki/89,J Clin End Metabol/68/180?,Suhr/89,Mol End/3/1693
MAP
response to infections such as Reckettsia riketsii
J Pharm Science/91/1-7
Li, JD/03
This article highlights the novel takeover of a host cells respiratory cell netword
3-ab
NAD+/ATP?
PARP
brain res/829/46
takahashi/99
other inhib act to diminish stroke/Takahashi/99/inflamm dis/Chiarugi/00/circ shock/Mcdonald/00
receptor response to/exercise/inflammation/histamine/lactic acid/ Mg+2/bradykinin/K+/adenosine/H+
Dilation/arteriolar/tissue blood flow
sympathetic vasoconstriction at arteriolar level/ except via autoregulation
Clin Phys mad rediculously simple/3d ed/14
goldberg, stephen/99
This book has quite a few excellent drawingsand does make phys rediculously simple
Anakinra /Kineret
Binding IL-1R/antagonist to IL1
sepsis / rheumatoid arthritis/ra
Anakinra (Kineret, Amgen, Thousand Oaks, CA) Approved for sepsis and rheumatoid arthritis Binds IL-1 receptor as an antagonist
chemical carcinogens
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
wik
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
wik
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
CD25
tolerance/ self ags
autoimmunity if system is intact
J Immunol./155/1151–64
Sakaguchi S/ Sakaguchi N/Asano M,/95
Sakaguchi S, Sakaguchi N, Asano M, et al. Immunological self-tolerance maintained by activated T-cells expressing IL-2 receptor alpha-chain (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune-diseases. J Immunol. 1995/155:1151–64.
tolerance/ self ags
autoimmunity if system is intact
J Immunol./155/1151–64
Sakaguchi S/ Sakaguchi N/Asano M,/95
Sakaguchi S, Sakaguchi N, Asano M, et al. Immunological self-tolerance maintained by activated T-cells expressing IL-2 receptor alpha-chain (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune-diseases. J Immunol. 1995/155:1151–64.
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
LAK cell
TGF-B reciprocal activation/regulation via
J Imm/140/2312
Espevik/87
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
LAK cell
TGF-B reciprocal activation/regulation via
J Imm/140/2312
Espevik/87
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
Anakinra /Kineret
Binding IL-1R/antagonist to IL1
sepsis / rheumatoid arthritis/ra
Anakinra (Kineret, Amgen, Thousand Oaks, CA) Approved for sepsis and rheumatoid arthritis Binds IL-1 receptor as an antagonist
Binding IL-1R/antagonist to IL1
sepsis / rheumatoid arthritis/ra
Anakinra (Kineret, Amgen, Thousand Oaks, CA) Approved for sepsis and rheumatoid arthritis Binds IL-1 receptor as an antagonist
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
ornithine
LAK activity
NK cell activity/MS outcome
cell immun.
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
hv/Hypovolemia**
thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++
strength in physical realm/+/pride/ego/self
Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/
God/?
+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani
thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++
strength in physical realm/+/pride/ego/self
Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/
God/?
+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani
ornithine
lak activity
arginase/*me/th2 prolif.
cell imm/132/451
arginase dec ornithine
Hypovolemia**
thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++
strength in physical realm/+/pride/ego/self
Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/
God/?
+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani
thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++
strength in physical realm/+/pride/ego/self
Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/
God/?
+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani
GLYCEROL KINASE
gENE DATA/TGTAATGCTGGTACAAGGCAGCTGGCAACGTTCCCTTCAAGACACAGAGGAGAAATCCAGATCATTCTC/atp MAKER
ATP
gENE DATA/TGTAATGCTGGTACAAGGCAGCTGGCAACGTTCCCTTCAAGACACAGAGGAGAAATCCAGATCATTCTC/atp MAKER
ATP
chemical carcinogens
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
wik
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
crh Receptor - One stimulation
anxiety/anorexia
peace/food intake
brain res rev/15/71
hotta,m/99
sleep/ condition OSA
significant IL6 elevation in breath condensate
wakefulness
chest/122/4/1162
compagnano, ge/02
phloretin
inhibition of muscle pO4lation
glucose uptake by RBC
dbr/13c/295
dbr/86
OXFORD PRESS
tgf-B
LAK
j imm/140/7312
Espevik/88
IL2
IL1/cAMP
LGL-LAK/IL4
J clin inves/85/6/1909
Chouaib,S/90
LT/ET
bA toxins/cAMP
PKA induced T-cell activation via /interuption of /intracellular signaling/MAPK*/MEK associated transcription factors/SAK p38/TCR events
trends immunology/27/9/434
baldari, cosima/06
erk1/erk2*
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
inhibition of muscle pO4lation
glucose uptake by RBC
dbr/13c/295
dbr/86
OXFORD PRESS
tgf-B
LAK
j imm/140/7312
Espevik/88
IL2
IL1/cAMP
LGL-LAK/IL4
J clin inves/85/6/1909
Chouaib,S/90
LT/ET
bA toxins/cAMP
PKA induced T-cell activation via /interuption of /intracellular signaling/MAPK*/MEK associated transcription factors/SAK p38/TCR events
trends immunology/27/9/434
baldari, cosima/06
erk1/erk2*
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
War on Drugs or Civil War part II
Round up the usual suspects!" In the classic film Casablanca, that was the automatic response by Louie, the police inspector, whenever a crime was committed. I've seen that movie about a dozen times, and the line always gets a laugh, even from the most jaded audience.
I doubt that Thomas Butler would laugh, though. On 3 September, in federal court in Lubbock, Texas, Dr. Butler, a 62-year old professor of medicine who is chief of the division of infectious diseases at Texas Tech University, pleaded not guilty to a 69-count indictment on charges that included illegal transportation of plague bacteria from Tanzania into and within the United States; lying to the Federal Bureau of Investigation (FBI) by claiming that 30 vials of the bacterial samples had been stolen when in fact, according to the FBI, he had destroyed them; embezzlement; tax evasion; and mail fraud. The case is scheduled to go to trial in November. Meanwhile, Dr. Butler remains free on $100,000 bail. Although he cannot, by the terms of his release, visit his laboratory and files at Texas Tech, with the help of a colleague at Johns Hopkins he managed last week to submit a paper to The Lancet on the effectiveness of different antibiotics against the plague.
There is a Kafkaesque quality to this story, which has so concerned biologists in the US that last week the National Academy of Sciences' Committee on Human Rights wrote to scientists urging them to protest at Dr. Butler's treatment at the hands of his own government and urging them to donate money for his legal bills, which are said to approach half a million US dollars already. The president of the Academy, Bruce Alberts, and the president of the affiliated Institute of Medicine, Harvey Fineberg, wrote a letter to John Ashcroft, the US Attorney General, on 15 August, stating that the case against Butler was "troubling" and likely to have a negative "impact on other scientists who may be discouraged from embarking on or continuing crucial bioterrorism-related scientific research."
My information on the Butler case comes from a variety of sources, including Eileen Choffnes of the Policy and Global Affairs Division of the Academy and some excellent pieces by Scott Shane, a reporter for the Baltimore Sun, and Ceci Connolly of the Washington Post. To begin with, it is important to realize that Dr. Butler is a recognized authority on infectious diseases, widely respected in that community, and a particular expert on the plague. His troubles stem from a series of trips he made in 1994 and 2002 as part of his research into the most effective treatments for plague, a bacterial disease that may have killed as much as a third of Europe's total population during the Black Death in the Middle Ages. On these trips he carried with him a number of vials containing samples of Yersinia pestis, the plague-causing bacterium. One of the charges against him is that he failed to properly report that he was carrying such specimens - even though this method of transport, which is clearly safer than sending them through the post, is so common that there is even a nickname for it in the microbiological community: VIP ('vials in the pocket'). The government's outrage seems as disingenuous as Louie's ("I am shocked - SHOCKED! - to find that gambling has been going on here," he says to bar owner Rick, just before a croupier hands him his winnings in another classic scene from Casablanca). But this incident would never have caught the attention of the government except for what happened next. Last January, for reasons that are still unclear and probably will remain so until Dr. Butler testifies in his own defense at his trial, he reported to officials at his university that 30 vials of the bacteria were missing from his laboratory.
Fearing that the samples may have been stolen by terrorists, Texas Tech immediately called in the FBI, who in turn notified the newly-created Department of Homeland Security. Within days, more than 60 law-enforcement agents had descended onto the normally sleepy campus in the west Texas town of Lubbock, a city whose previous claim to fame was as the birthplace of the legendary rock-and-roller Buddy Holly. Butler, his supporters allege, was taken away in handcuffs and interrogated for ten hours straight through the night without having an attorney present. What happened next is unclear, but sources say that, at around 3 am, he finally signed a statement saying that the plague vials had been "accidentally destroyed earlier" and that his assertion that they were missing was "inaccurate". He claims that he signed the paper because the FBI agents told him it was necessary to end the investigation. Instead, in April, he was indicted on 15 felony counts. During the first week of September, these charges were expanded to include mail fraud and embezzlement in connection with research that he conducted for two pharmaceutical companies. The indictment states that he received almost a third of a million dollars in payment from the companies without reporting the income to his employer, the university. Butler's supporters allege that these new charges are an attempt to divert attention from the weakness of the original charges relating to the plague samples. They believe that the FBI, the Department of Justice, and the Department of Homeland Security need a "victory" in the war against terrorism to distract the public from the failure of their investigation into the anthrax-laced letters incident, and that Butler is being used as a scapegoat. Through his attorneys, he denies wrongdoing in connection with payments from his pharmaceutical company work. Meanwhile, the whereabouts of some 30 vials of deadly germs remain unknown: Dr. Butler asserts that the statement he signed under duress was false, and that he has no memory of actually destroying the vials.
Without drawing conclusions as to Dr. Butler's guilt or innocence, one can conclude on the basis of the evidence available so far that he has acted somewhat peculiarly, and possibly stupidly. But that doesn't make him a criminal, and it seems to me that the government's prosecution is far out of proportion to any offences he may have actually committed. This whole affair has the smell of a witch hunt about it, and it's pretty easy to guess why. Federal agents and the government officials who control them need to produce culprits from time to time to prove that they are doing their jobs. It's much easier to prosecute a hapless individual who can be induced to admit guilt to something than to do the difficult - sometimes, to be fair, impossible - work of finding out what really happened in a situation where imperfect memory, faulty record-keeping, and the general sloppiness common to many scientists make tracing samples a logistical nightmare.
But I don't entirely agree with the Academy's claim that Butler's prosecution - some would say persecution - will necessarily have a chilling effect on research into the genomics, biochemistry and physiology of pathogenic microbes. Scientists go where the money is, and right now, in the US at least, there is a lot of money for biodefense-related studies. Funding trumps fear. What will happen, I think, is that any scientist with more brains than a gerbil will think twice before reporting any discrepancy or possible theft of biohazardous material to either his or her institution or to the government. Why raise an alarm when the reaction is likely to be to shoot the messenger, or at least to try to send the messenger to jail for a long time? The unintended consequence of the Butler affair is likely to be that it will become more difficult for governments to fight bioterrorism, because their natural allies, their own scientists, will not trust those governments to treat them as allies. Why chase terrorists who are hard to find when you can bring to the dock people you already know? Don't all witch hunts concentrate, not on outsiders, but on those close to home?
Witch hunts make the hunters famous and powerful, at least for a time, which probably accounts for their recurring popularity throughout history as an instrument of policy. And witch hunts begin with rounding up the usual suspects. In the post-genomic world of bioterrorism, it would seem it is the biologists, not the terrorists, who are most likely to become the usual suspects. And although one would hope that governments and scientists would naturally work together against the misuse of science and technology, the Butler affair makes one fear that, unlike the case of Louie and Rick at the end of Casablanca, this will not be the beginning of a beautiful friendship.
Please send any monies to the following address and join the group at
DRCNet needs your support! Donations can be made by credit card at
http://stopthedrugwar.org/donate/donate.shtml or sent by mail to P.O. Box 18402, Washington, DC 20036-8402. Donations to the Drug Reform Coordination Network are not tax-deductible. Deductible contributions supporting our educational work can be made by check to the DRCNet Foundation, a 501(c)(3) tax-exempt organization, same address.
I doubt that Thomas Butler would laugh, though. On 3 September, in federal court in Lubbock, Texas, Dr. Butler, a 62-year old professor of medicine who is chief of the division of infectious diseases at Texas Tech University, pleaded not guilty to a 69-count indictment on charges that included illegal transportation of plague bacteria from Tanzania into and within the United States; lying to the Federal Bureau of Investigation (FBI) by claiming that 30 vials of the bacterial samples had been stolen when in fact, according to the FBI, he had destroyed them; embezzlement; tax evasion; and mail fraud. The case is scheduled to go to trial in November. Meanwhile, Dr. Butler remains free on $100,000 bail. Although he cannot, by the terms of his release, visit his laboratory and files at Texas Tech, with the help of a colleague at Johns Hopkins he managed last week to submit a paper to The Lancet on the effectiveness of different antibiotics against the plague.
There is a Kafkaesque quality to this story, which has so concerned biologists in the US that last week the National Academy of Sciences' Committee on Human Rights wrote to scientists urging them to protest at Dr. Butler's treatment at the hands of his own government and urging them to donate money for his legal bills, which are said to approach half a million US dollars already. The president of the Academy, Bruce Alberts, and the president of the affiliated Institute of Medicine, Harvey Fineberg, wrote a letter to John Ashcroft, the US Attorney General, on 15 August, stating that the case against Butler was "troubling" and likely to have a negative "impact on other scientists who may be discouraged from embarking on or continuing crucial bioterrorism-related scientific research."
My information on the Butler case comes from a variety of sources, including Eileen Choffnes of the Policy and Global Affairs Division of the Academy and some excellent pieces by Scott Shane, a reporter for the Baltimore Sun, and Ceci Connolly of the Washington Post. To begin with, it is important to realize that Dr. Butler is a recognized authority on infectious diseases, widely respected in that community, and a particular expert on the plague. His troubles stem from a series of trips he made in 1994 and 2002 as part of his research into the most effective treatments for plague, a bacterial disease that may have killed as much as a third of Europe's total population during the Black Death in the Middle Ages. On these trips he carried with him a number of vials containing samples of Yersinia pestis, the plague-causing bacterium. One of the charges against him is that he failed to properly report that he was carrying such specimens - even though this method of transport, which is clearly safer than sending them through the post, is so common that there is even a nickname for it in the microbiological community: VIP ('vials in the pocket'). The government's outrage seems as disingenuous as Louie's ("I am shocked - SHOCKED! - to find that gambling has been going on here," he says to bar owner Rick, just before a croupier hands him his winnings in another classic scene from Casablanca). But this incident would never have caught the attention of the government except for what happened next. Last January, for reasons that are still unclear and probably will remain so until Dr. Butler testifies in his own defense at his trial, he reported to officials at his university that 30 vials of the bacteria were missing from his laboratory.
Fearing that the samples may have been stolen by terrorists, Texas Tech immediately called in the FBI, who in turn notified the newly-created Department of Homeland Security. Within days, more than 60 law-enforcement agents had descended onto the normally sleepy campus in the west Texas town of Lubbock, a city whose previous claim to fame was as the birthplace of the legendary rock-and-roller Buddy Holly. Butler, his supporters allege, was taken away in handcuffs and interrogated for ten hours straight through the night without having an attorney present. What happened next is unclear, but sources say that, at around 3 am, he finally signed a statement saying that the plague vials had been "accidentally destroyed earlier" and that his assertion that they were missing was "inaccurate". He claims that he signed the paper because the FBI agents told him it was necessary to end the investigation. Instead, in April, he was indicted on 15 felony counts. During the first week of September, these charges were expanded to include mail fraud and embezzlement in connection with research that he conducted for two pharmaceutical companies. The indictment states that he received almost a third of a million dollars in payment from the companies without reporting the income to his employer, the university. Butler's supporters allege that these new charges are an attempt to divert attention from the weakness of the original charges relating to the plague samples. They believe that the FBI, the Department of Justice, and the Department of Homeland Security need a "victory" in the war against terrorism to distract the public from the failure of their investigation into the anthrax-laced letters incident, and that Butler is being used as a scapegoat. Through his attorneys, he denies wrongdoing in connection with payments from his pharmaceutical company work. Meanwhile, the whereabouts of some 30 vials of deadly germs remain unknown: Dr. Butler asserts that the statement he signed under duress was false, and that he has no memory of actually destroying the vials.
Without drawing conclusions as to Dr. Butler's guilt or innocence, one can conclude on the basis of the evidence available so far that he has acted somewhat peculiarly, and possibly stupidly. But that doesn't make him a criminal, and it seems to me that the government's prosecution is far out of proportion to any offences he may have actually committed. This whole affair has the smell of a witch hunt about it, and it's pretty easy to guess why. Federal agents and the government officials who control them need to produce culprits from time to time to prove that they are doing their jobs. It's much easier to prosecute a hapless individual who can be induced to admit guilt to something than to do the difficult - sometimes, to be fair, impossible - work of finding out what really happened in a situation where imperfect memory, faulty record-keeping, and the general sloppiness common to many scientists make tracing samples a logistical nightmare.
But I don't entirely agree with the Academy's claim that Butler's prosecution - some would say persecution - will necessarily have a chilling effect on research into the genomics, biochemistry and physiology of pathogenic microbes. Scientists go where the money is, and right now, in the US at least, there is a lot of money for biodefense-related studies. Funding trumps fear. What will happen, I think, is that any scientist with more brains than a gerbil will think twice before reporting any discrepancy or possible theft of biohazardous material to either his or her institution or to the government. Why raise an alarm when the reaction is likely to be to shoot the messenger, or at least to try to send the messenger to jail for a long time? The unintended consequence of the Butler affair is likely to be that it will become more difficult for governments to fight bioterrorism, because their natural allies, their own scientists, will not trust those governments to treat them as allies. Why chase terrorists who are hard to find when you can bring to the dock people you already know? Don't all witch hunts concentrate, not on outsiders, but on those close to home?
Witch hunts make the hunters famous and powerful, at least for a time, which probably accounts for their recurring popularity throughout history as an instrument of policy. And witch hunts begin with rounding up the usual suspects. In the post-genomic world of bioterrorism, it would seem it is the biologists, not the terrorists, who are most likely to become the usual suspects. And although one would hope that governments and scientists would naturally work together against the misuse of science and technology, the Butler affair makes one fear that, unlike the case of Louie and Rick at the end of Casablanca, this will not be the beginning of a beautiful friendship.
Please send any monies to the following address and join the group at
DRCNet needs your support! Donations can be made by credit card at
http://stopthedrugwar.org/donate/donate.shtml or sent by mail to P.O. Box 18402, Washington, DC 20036-8402. Donations to the Drug Reform Coordination Network are not tax-deductible. Deductible contributions supporting our educational work can be made by check to the DRCNet Foundation, a 501(c)(3) tax-exempt organization, same address.
Alonzo Peters MD videographer-photographer-historian
Alonzo Peters MD videographer-photographer-historian
I have been blessed a videographer since 1984. I believe this is when I bought my first clunker Panasonic tube camera. It had a portable unit with it that recorded to VHS. This was simply a love that I had for it.If I had listed to some very good advice and had the time the company created with the help of JoAnna Chevalier would have been worth about $7,000,000.
Everyone is doing now what we started. We were doing churches weddings and plays back then. I have some very old footage of Beyonce when she was about 4 years old.Actually the shots I have of my Dad and family are worth far more than $7,000,000. I would not take 7 trillion dollars for them.
I am reading a book called "How to write Unforgettable Characters" It deals with the particulates of "creating" unforgettable and loveable or whatever characters. One of the parts involves a quote of Jung as saying the past can be good or looked upon as good. It certainly has for me with the exception of several choices made of mates. I should have remained their friends in some cases, in others I should not have allowed myself to be adulterated by their hate of their past.
This video-photo-therapy involves seeing years of Sunday School teaching, singing in the church choir, teaching-tutoring math, performing in the community band in Columbia Mo. called Ghetto. It is something that proved to me that you are only a product of your environment.If I am being held liable for an action that I appeared to be doing, my guilt is only by association, yet I am blessed to have been associated with everyone that has come into contact with me.Enough of this rambling, let me give you some more info and documentation.
Let me in public thank God for leading me when I was unleadable and for restoring me to sanity. I thank Him for ordering my steps in His Word
Alonzo Peters MD
I have been blessed a videographer since 1984. I believe this is when I bought my first clunker Panasonic tube camera. It had a portable unit with it that recorded to VHS. This was simply a love that I had for it.If I had listed to some very good advice and had the time the company created with the help of JoAnna Chevalier would have been worth about $7,000,000.
Everyone is doing now what we started. We were doing churches weddings and plays back then. I have some very old footage of Beyonce when she was about 4 years old.Actually the shots I have of my Dad and family are worth far more than $7,000,000. I would not take 7 trillion dollars for them.
I am reading a book called "How to write Unforgettable Characters" It deals with the particulates of "creating" unforgettable and loveable or whatever characters. One of the parts involves a quote of Jung as saying the past can be good or looked upon as good. It certainly has for me with the exception of several choices made of mates. I should have remained their friends in some cases, in others I should not have allowed myself to be adulterated by their hate of their past.
This video-photo-therapy involves seeing years of Sunday School teaching, singing in the church choir, teaching-tutoring math, performing in the community band in Columbia Mo. called Ghetto. It is something that proved to me that you are only a product of your environment.If I am being held liable for an action that I appeared to be doing, my guilt is only by association, yet I am blessed to have been associated with everyone that has come into contact with me.Enough of this rambling, let me give you some more info and documentation.
Let me in public thank God for leading me when I was unleadable and for restoring me to sanity. I thank Him for ordering my steps in His Word
Alonzo Peters MD
Alonzo Peters MD creator of CYTOKINE NEWS
CYTOKINE NEWS
Thursday, December 27, 2007
www.advancedmedinfo.com now with 411 on robotics
Please post your information after touching the Peters' Productions. It will pull up the frontpage. This allows you to advance your information to medical and now robotic information.We are beefing up the info in an effort to advance both the medical and robotic fields.The following gives evidence of the necessity of following the 2 technologies. This is from an article on self-reconfiguring robotics."The quest for self-reconfiguring robotic structures is to some extent inspired by envisioned applications such as long-term space missions, that require long-term self-sustaining robotic ecology that can handle unforeseen situations and may require self repair. A second source of inspiration are biological systems that are self-constructed out of a relatively small repertoire of lower-level building blocks (cells or amino acids, depending on scale of interest). This architecture underlies biological systems’ ability to physically adapt, grow, heal, and even self replicate – capabilities that would be desirable in many engineered systems."How bout them apples Charlene?A. Peters MD713-882-7209pete4doc@hotmail.com
Posted by Alonzo Peters MD at 5:06 PM 0 comments Links to this post
Thursday, December 20, 2007
To all Patients and Staff of North Medical Center MERRY CHRISTMAS
Merry Christmas on behalf of North Medical Center. I thank all the patients and staff including the "illegals", if there can be such a thing. It was only for you, that we, including the loyal staff that we had, unknowingly play Marcus Welby AND Robin Hood. It is the now one year anniversary of my Father's death and it is in memory of what he taught me of self-sufficiency for the community as a Fahim and being patient with the enemy that we give you a heartfelt Merry Chrismas this day.We wish you a Merry Christmas, in the spirit of resolving our drive to gain humanity and better health care for poor Hispanics, Blacks and Whites who were undertreated "by any means necessary". Our involvement was extended from a history of involvement. This extension was from working with the "Free Clarence Bradley" as videographer and musician, offering our own music lessons at OTO , and working with the justice for Ida Lee Delaney. We performed, donated and made many trips out of town increasing the numbers. We have been active church members teaching Sunday School and performing in the Male Chorus. We have gone and performed in medical- missionary trips prior to this trial . It is in me knowing where my Father is that I find strength to trust in God and strengthen my personal relationship with HIM. These community activities have all been documented on video audio and pictures, and are available on request, through a daily lifecoach that we call BIBLEBOOST. (Write pob 14089, Houston Tx 77221 send $12.00 for handling. )We were not drug dealers, and merely involved in prescribing narcotics. You all know what we have offered in the Spirit of Christ, including full medical care, vaccinations, lab, ultrasounds, counseling and included referrals to specialists with 10 commandments. You could bring ANYBODY in for this care especially your family. We had a dental suite in the works. We offered visits for five dollars only and we provided house visits. There were plans with one of the pharmacists for schools and scholarships. We are hated by those who could not compete with the quality and quantity of care and our love, and by those who chose to persecute us with legal scrutiny subsequent to their actions and prosecution.Nevertheless, in the Spirit of Christ we must continue to pray for the enemy. Pray for the DEA, IRS and their chief agents. GOD is still on the throne and the battle is HIS. I have grown in this experience. I do not know how else He will bless us again, but as of now I have become a better doctor, musician, father, medical researcher, Christian, son, brother and cousin. This has occurred in part by being in recovery from self treatment of bipolar disorder with alcohol and other substances for over 2 years now on a day to day basis. It is refreshing to see my patients who I know see a change of increased vigor and hope in me. Oh yes I am still "crazy", crazy for you. It has been enlightening to look at how I played a part in the closing of the practice including the surrender of my license to practice medicine , which was in part a manifestation of my insanity and ignorance.Please keep me in your prayers. Please pray for the invention . IT IS YOURS. Pray for it to prosper and flourish. It is because of your patronage and prayers thus far that Advanced Medical Informatics and Education has published books and found cures. This is for you and those in the future especially for other prospective patients. Do not fool yourselves. You know who you are. It is because of you that there is hope irregardless of the outcome of this trial. As of now we are negotiating a stronger position financially and I promise you, I would suffer all the betrayal, loss, violence, lies and malice again to have 1. the fellowship of suffering with Him and 2. Have my mind made up to follow Him and 3. Be steadfast in seeing the invention through to propose a theory of all disease cure as it relates to inflammation. We CAN DO ALL THINGS.....I promise you I love you all more this Christmas. I promise you that this is my best Christmas ever because of my relationship with Christ. You are part of my family and one day the North Medical Center will rise again to provide the same level of care that it had in the past.Sincerely,Alonzo Peters MD713-882-7209pete4doc@hotmail.com
Posted by Alonzo Peters MD at 8:00 AM 0 comments Links to this post
Monday, December 17, 2007
IL10
Interleukin 10 appears to have a pivotal role both in renal , cancer physiology and other physiologies.Being involved with cycooxygenase, the juxta-glomerular apparatus and the regulation of the renin-angiotensin apparatus plus the "turn off" function of tumor surveillance (similar to pregnancy) makes this a very pivotal Interleukin.Please write us for correspondance and references.pete4doc@hotmail.com
Posted by Alonzo Peters MD at 4:12 PM 0 comments Links to this post
Sunday, December 16, 2007
Inflammation or Lack Thereof
The cytokine network is repleat with possibilities for involvement in all disease including psychiatric diseases such as bi-polar disorder. The paradigm of sympathizing with either of the Mossman et al discovered Th1 vs Th2 systems allows for categorization, and also leads to possibilities of treatments. For example the Th2 cytokine IL10 may be involved in certain leukemias such as AML.Although specific data has recently revealed this as a possibility, the Model of Inflammationdrawn in 1990 revealed this as a possibility (see http://www.advancedmedinfo.com/ then go to Peters' Productions and apply for password). The proposed Inflammatory Chain articulates with the Krebs, Urea, Respiratory, Glycolytic and Glutathione Chains as well as the Human Genome Project data being involved in translation and transcription (linked 3d model being drawn)The latest hope for cures for cancers including leukemias and other diseases have been the relatively recent revelation that micro RNA(miRNA) which controls proliferation of cells is under the control of the TH1 inflammatory group of cytokines. These cytokines include TNF, IL1 and IL6.Of course the myriad of pleiotrophic reactions and cytokines with receptors and chains makes it impossible to fathom without a software. This software is free for your using by visiting our site above. It is called AMIE TM (Advanced Medical Informatics Education) . This is offered as a Christmas gift in order to offer hope to our patients, family, friends, and foes.http://www.advancedmedinfo.com/ to Peters' Productions to apply for password.We are privately owned. Strictly for the advancement of scientific knowledge we accept donations addressed to: C and P Constructs4404 Richard PlaceSt. Louis Mo. 63115
Posted by Alonzo Peters MD at 6:43 PM 0 comments Links to this post
Labels: Bipolar Disorder, cytokine, Glycolytic cycle. Glutathione.Cancer, Human Genome project. Urea, Krebs, receptors
Subscribe to: Posts (Atom)
Blog Archive
▼ 2007 (4)
▼ December (4)
www.advancedmedinfo.com now with 411 on robotics
To all Patients and Staff of North Medical Center...
IL10
Inflammation or Lack Thereof
Alonzo Peters MD FAAFP** Fellow American Academy of Family Practice contact : pete4doc@hotmail.com 713-882-7209AML –Acute Myelogenous Leukemia(Cancer), Coagulation, and BiPolar Disorders,as examples of immune dysfunction as well as factors associated with natural anti-iflammatory function Part of Advanced Medical Informatic and Education’sAMIE TMjustificationAn argument and Medical Manifesto of all physiology/pathophysiology as relative to a proposedCytokine Physiologic AntiInflammatory Cascade which articulates with heretofore known Urea, Glycolytic, respiratory, TCA, glutathione chains/cycle as an aid to the citizens of the USA and world in disease prevention and treatmentBackGround 12-03-07We classically looked at Inflammation as Dolor, Rubor, Calor and loss of function. Yet without knowing the actual function or physiology of the ‘flame” in inflammation we were at loss to know some of its dysfunction in inflammation. Cytokines, aka Interleukins –Ils(1), and their receptors including, IL10 (Interleukin 10) , IL6 , IL8, TNF (tumor necrosis factor)1, all appear to be involved in AML and cancer in general as well as many other processes which lead to disease (4). As yet Cytokines and their receptors have not been related to all normal physiologic processes including conception and all disease. Cytokines and their receptors have been related to a MODEL (see below) of an invented Pathophysiology of Inflammatory Manifestations and Process (IMPay) . This in essence originally related only a limited number of diseases to a pathophysiologic inflammatiory cascade as being responsible for the consequences of only a few diseases including AML,MS and Lupus.. On the other hand, a software that relates the IMPay MODEL with the known physology of the Neuro-Humeral-Immune ( NHI)(5) function was later named AMIE TM. ( a product of Peters’ Production and C and P Construction). This coordination of AMIE TM, NHI and heretofore established metabolic cycles including Krebs, Glycolytic, Respiratory, Glutathione Urea, endocrine along with newly discovered Human Genome Project (including micro RNA) allows for the lumping of all medical data into a query data-base for comparison and critique of potential exacerbating and curative variables. This is made possible only through computers and software. We have invented the software and propose a new MODEL which integrates the aforementioned to all DISease and normal physiology of the inflammatory process which sometimes does not result in inflammation.Part of this integration acknowledges cytokine physiology, action and function as a type of hormone. A cytokine appears to be similar to the endocrine hormone’s (6) in 1. stimulating a receptor, 2. receptor-cytokine movement towards the nucleus and 3. subsequently stimulation of transcription and translation. Thus AMIE TM supercedes all previous medical knowledge in incorporating newly discovered principles measured in nanomoler quantities as cytokines (interchanchably referred to as interleukins IL-x) and their receptors into a paradigm of a hypothesized integrative chain. If f gone awry the MODEL results in dis-ease including psychiatric(7).The motivation and courage for discovering the possibilities of cures from other sources included James Fredrick Jones death of leukemia, childhood buddies Leatha Mayes Cassandra Williams Edwin Temple’s deaths from Lupus / MS and last but not least the Leonard Moises death from renal cell carcinoma .In summary AMIE TM is tripartite,3D and involves 1. A Physiologic Model of Inflammation involving the normal physiology of Inflammation proposing an end in Th1 and Th2 manifestations of normal physiologic and pathophysiologic nature 2. An Abbreviation Data Base 3. A Dialectic Query Centered Database assimilating and questioning the totality of pre-existing biochemical, chemical, physics, physiologic, mathematical, linguistic, eastern/African medical and Index Medicus data. This in essence identifies contradictions and eliminates potential duplicated and erroneous data. It also shows the importance of a cision of the CiC - inflammatory cascade into a Th1 (predominantly cellular inflammatory nomenclature response (compare to catabolic) of IL1, IL6 and TNF division and a Th2 (IL4. IL10) division of maintenance and specificity via antibodies and allergy (compare to anabolic)Original Cytokine Cascade of inflammation and its Consequence IMPay MODEL+ available to expand
Have you ever heard of cytokines and normal body functions?
Thursday, December 27, 2007
www.advancedmedinfo.com now with 411 on robotics
Please post your information after touching the Peters' Productions. It will pull up the frontpage. This allows you to advance your information to medical and now robotic information.We are beefing up the info in an effort to advance both the medical and robotic fields.The following gives evidence of the necessity of following the 2 technologies. This is from an article on self-reconfiguring robotics."The quest for self-reconfiguring robotic structures is to some extent inspired by envisioned applications such as long-term space missions, that require long-term self-sustaining robotic ecology that can handle unforeseen situations and may require self repair. A second source of inspiration are biological systems that are self-constructed out of a relatively small repertoire of lower-level building blocks (cells or amino acids, depending on scale of interest). This architecture underlies biological systems’ ability to physically adapt, grow, heal, and even self replicate – capabilities that would be desirable in many engineered systems."How bout them apples Charlene?A. Peters MD713-882-7209pete4doc@hotmail.com
Posted by Alonzo Peters MD at 5:06 PM 0 comments Links to this post
Thursday, December 20, 2007
To all Patients and Staff of North Medical Center MERRY CHRISTMAS
Merry Christmas on behalf of North Medical Center. I thank all the patients and staff including the "illegals", if there can be such a thing. It was only for you, that we, including the loyal staff that we had, unknowingly play Marcus Welby AND Robin Hood. It is the now one year anniversary of my Father's death and it is in memory of what he taught me of self-sufficiency for the community as a Fahim and being patient with the enemy that we give you a heartfelt Merry Chrismas this day.We wish you a Merry Christmas, in the spirit of resolving our drive to gain humanity and better health care for poor Hispanics, Blacks and Whites who were undertreated "by any means necessary". Our involvement was extended from a history of involvement. This extension was from working with the "Free Clarence Bradley" as videographer and musician, offering our own music lessons at OTO , and working with the justice for Ida Lee Delaney. We performed, donated and made many trips out of town increasing the numbers. We have been active church members teaching Sunday School and performing in the Male Chorus. We have gone and performed in medical- missionary trips prior to this trial . It is in me knowing where my Father is that I find strength to trust in God and strengthen my personal relationship with HIM. These community activities have all been documented on video audio and pictures, and are available on request, through a daily lifecoach that we call BIBLEBOOST. (Write pob 14089, Houston Tx 77221 send $12.00 for handling. )We were not drug dealers, and merely involved in prescribing narcotics. You all know what we have offered in the Spirit of Christ, including full medical care, vaccinations, lab, ultrasounds, counseling and included referrals to specialists with 10 commandments. You could bring ANYBODY in for this care especially your family. We had a dental suite in the works. We offered visits for five dollars only and we provided house visits. There were plans with one of the pharmacists for schools and scholarships. We are hated by those who could not compete with the quality and quantity of care and our love, and by those who chose to persecute us with legal scrutiny subsequent to their actions and prosecution.Nevertheless, in the Spirit of Christ we must continue to pray for the enemy. Pray for the DEA, IRS and their chief agents. GOD is still on the throne and the battle is HIS. I have grown in this experience. I do not know how else He will bless us again, but as of now I have become a better doctor, musician, father, medical researcher, Christian, son, brother and cousin. This has occurred in part by being in recovery from self treatment of bipolar disorder with alcohol and other substances for over 2 years now on a day to day basis. It is refreshing to see my patients who I know see a change of increased vigor and hope in me. Oh yes I am still "crazy", crazy for you. It has been enlightening to look at how I played a part in the closing of the practice including the surrender of my license to practice medicine , which was in part a manifestation of my insanity and ignorance.Please keep me in your prayers. Please pray for the invention . IT IS YOURS. Pray for it to prosper and flourish. It is because of your patronage and prayers thus far that Advanced Medical Informatics and Education has published books and found cures. This is for you and those in the future especially for other prospective patients. Do not fool yourselves. You know who you are. It is because of you that there is hope irregardless of the outcome of this trial. As of now we are negotiating a stronger position financially and I promise you, I would suffer all the betrayal, loss, violence, lies and malice again to have 1. the fellowship of suffering with Him and 2. Have my mind made up to follow Him and 3. Be steadfast in seeing the invention through to propose a theory of all disease cure as it relates to inflammation. We CAN DO ALL THINGS.....I promise you I love you all more this Christmas. I promise you that this is my best Christmas ever because of my relationship with Christ. You are part of my family and one day the North Medical Center will rise again to provide the same level of care that it had in the past.Sincerely,Alonzo Peters MD713-882-7209pete4doc@hotmail.com
Posted by Alonzo Peters MD at 8:00 AM 0 comments Links to this post
Monday, December 17, 2007
IL10
Interleukin 10 appears to have a pivotal role both in renal , cancer physiology and other physiologies.Being involved with cycooxygenase, the juxta-glomerular apparatus and the regulation of the renin-angiotensin apparatus plus the "turn off" function of tumor surveillance (similar to pregnancy) makes this a very pivotal Interleukin.Please write us for correspondance and references.pete4doc@hotmail.com
Posted by Alonzo Peters MD at 4:12 PM 0 comments Links to this post
Sunday, December 16, 2007
Inflammation or Lack Thereof
The cytokine network is repleat with possibilities for involvement in all disease including psychiatric diseases such as bi-polar disorder. The paradigm of sympathizing with either of the Mossman et al discovered Th1 vs Th2 systems allows for categorization, and also leads to possibilities of treatments. For example the Th2 cytokine IL10 may be involved in certain leukemias such as AML.Although specific data has recently revealed this as a possibility, the Model of Inflammationdrawn in 1990 revealed this as a possibility (see http://www.advancedmedinfo.com/ then go to Peters' Productions and apply for password). The proposed Inflammatory Chain articulates with the Krebs, Urea, Respiratory, Glycolytic and Glutathione Chains as well as the Human Genome Project data being involved in translation and transcription (linked 3d model being drawn)The latest hope for cures for cancers including leukemias and other diseases have been the relatively recent revelation that micro RNA(miRNA) which controls proliferation of cells is under the control of the TH1 inflammatory group of cytokines. These cytokines include TNF, IL1 and IL6.Of course the myriad of pleiotrophic reactions and cytokines with receptors and chains makes it impossible to fathom without a software. This software is free for your using by visiting our site above. It is called AMIE TM (Advanced Medical Informatics Education) . This is offered as a Christmas gift in order to offer hope to our patients, family, friends, and foes.http://www.advancedmedinfo.com/ to Peters' Productions to apply for password.We are privately owned. Strictly for the advancement of scientific knowledge we accept donations addressed to: C and P Constructs4404 Richard PlaceSt. Louis Mo. 63115
Posted by Alonzo Peters MD at 6:43 PM 0 comments Links to this post
Labels: Bipolar Disorder, cytokine, Glycolytic cycle. Glutathione.Cancer, Human Genome project. Urea, Krebs, receptors
Subscribe to: Posts (Atom)
Blog Archive
▼ 2007 (4)
▼ December (4)
www.advancedmedinfo.com now with 411 on robotics
To all Patients and Staff of North Medical Center...
IL10
Inflammation or Lack Thereof
Alonzo Peters MD FAAFP** Fellow American Academy of Family Practice contact : pete4doc@hotmail.com 713-882-7209AML –Acute Myelogenous Leukemia(Cancer), Coagulation, and BiPolar Disorders,as examples of immune dysfunction as well as factors associated with natural anti-iflammatory function Part of Advanced Medical Informatic and Education’sAMIE TMjustificationAn argument and Medical Manifesto of all physiology/pathophysiology as relative to a proposedCytokine Physiologic AntiInflammatory Cascade which articulates with heretofore known Urea, Glycolytic, respiratory, TCA, glutathione chains/cycle as an aid to the citizens of the USA and world in disease prevention and treatmentBackGround 12-03-07We classically looked at Inflammation as Dolor, Rubor, Calor and loss of function. Yet without knowing the actual function or physiology of the ‘flame” in inflammation we were at loss to know some of its dysfunction in inflammation. Cytokines, aka Interleukins –Ils(1), and their receptors including, IL10 (Interleukin 10) , IL6 , IL8, TNF (tumor necrosis factor)1, all appear to be involved in AML and cancer in general as well as many other processes which lead to disease (4). As yet Cytokines and their receptors have not been related to all normal physiologic processes including conception and all disease. Cytokines and their receptors have been related to a MODEL (see below) of an invented Pathophysiology of Inflammatory Manifestations and Process (IMPay) . This in essence originally related only a limited number of diseases to a pathophysiologic inflammatiory cascade as being responsible for the consequences of only a few diseases including AML,MS and Lupus.. On the other hand, a software that relates the IMPay MODEL with the known physology of the Neuro-Humeral-Immune ( NHI)(5) function was later named AMIE TM. ( a product of Peters’ Production and C and P Construction). This coordination of AMIE TM, NHI and heretofore established metabolic cycles including Krebs, Glycolytic, Respiratory, Glutathione Urea, endocrine along with newly discovered Human Genome Project (including micro RNA) allows for the lumping of all medical data into a query data-base for comparison and critique of potential exacerbating and curative variables. This is made possible only through computers and software. We have invented the software and propose a new MODEL which integrates the aforementioned to all DISease and normal physiology of the inflammatory process which sometimes does not result in inflammation.Part of this integration acknowledges cytokine physiology, action and function as a type of hormone. A cytokine appears to be similar to the endocrine hormone’s (6) in 1. stimulating a receptor, 2. receptor-cytokine movement towards the nucleus and 3. subsequently stimulation of transcription and translation. Thus AMIE TM supercedes all previous medical knowledge in incorporating newly discovered principles measured in nanomoler quantities as cytokines (interchanchably referred to as interleukins IL-x) and their receptors into a paradigm of a hypothesized integrative chain. If f gone awry the MODEL results in dis-ease including psychiatric(7).The motivation and courage for discovering the possibilities of cures from other sources included James Fredrick Jones death of leukemia, childhood buddies Leatha Mayes Cassandra Williams Edwin Temple’s deaths from Lupus / MS and last but not least the Leonard Moises death from renal cell carcinoma .In summary AMIE TM is tripartite,3D and involves 1. A Physiologic Model of Inflammation involving the normal physiology of Inflammation proposing an end in Th1 and Th2 manifestations of normal physiologic and pathophysiologic nature 2. An Abbreviation Data Base 3. A Dialectic Query Centered Database assimilating and questioning the totality of pre-existing biochemical, chemical, physics, physiologic, mathematical, linguistic, eastern/African medical and Index Medicus data. This in essence identifies contradictions and eliminates potential duplicated and erroneous data. It also shows the importance of a cision of the CiC - inflammatory cascade into a Th1 (predominantly cellular inflammatory nomenclature response (compare to catabolic) of IL1, IL6 and TNF division and a Th2 (IL4. IL10) division of maintenance and specificity via antibodies and allergy (compare to anabolic)Original Cytokine Cascade of inflammation and its Consequence IMPay MODEL+ available to expand
Have you ever heard of cytokines and normal body functions?
Alonzo Peters creator of AMIE
AMIE- advanced medical informatics and education
This blog was created to share the information that is fractionated now into separate factions. The Inflammatory Chain brings the parts into a whole that can be understood from conception unto death.
Thursday, January 3, 2008
Investigations into Mitochondrial and Respiratory Chain Dysfunction
In our zeal to deal with the tripartate nature of healing of our patients most recently from Beaumont's and Houston's St. Elizatbeth's Hospitals, VA, Methodist, St. Lukes, Citizen's General, Doctor's Airline , Southwest Memorial, Ross Avenue Medical in Dallas, and Riverside in Houston, we are never amazed at what new things God reveals through the internet.This information is meaningless unless assimilated into a logistical intelligent, retrieval system to be compared to other data that initially may not seem to be related. This has occurred with AMIE. A model was necessary at first and the abbreviation then dialectic query based artificially intelligent system flowed from it allowing a perpetuation of humility with new things discovered.The newest "discovery" of sorts relating all disease to an inflammatory paradigm was the discovery of 1. cytokine involvement in the conception process 2. cytokine involvement in the in utero process and 3 cytokine involvement in the normal functioning process of homeostasis. These were all predicated on the "absence" of inflammatory (dysfunction) which classically would have been the sign of the nanomolar abnormalities, that brought the dysfunction to our attention. A classic example is the involovement of TNF in Toxic Shock Syndrome, as well as meningococal disease, and the coagulatory , and cardiopulmonary complications of this cytokine when in excess.The reason for this is that in western allopathic medicine we classically perceive inflammation and disease as a bad thing in dolor rubor calor and lack of function but in observing its normal functioning components, it gives us superiority of perspective in preventing disease. The observation of a model of the immunologic sytem or chain gives insight into the possibility of cure of all disease. Without the "model" we have no map to find where we got lost because we did not know where we going in the first place.Well the absolute latest addition to this immunologic paradigm for all disease is a result of the search made today. Mitochondrial dysfunction is related to cytokine chain dysfunction which eventuates in respiratory chain dysfunction. The disease that started all the questions was Minimal Change Nephrotic Syndrome in Adults, its equivalent in kids and its manifestation in neurologic, renal cardiovascular, respiratory and orthopedic pathologies.My struggle is to overcome manifold obstacles to continue this research, so whether you are a boss, individual or patron, please step up to the plate and make donations. We are at the crossroads of greatness. Keep this blogg free and allow us to buy a couple of chickens and about 3 more good people for data input (in each city). A donation of $12oo will give youdomain over any "discovery" in your domain city. There will only be 3 "territorial divisions" from each city who will be awarded exclusivity.I love yaMail checks to C and P ConstructionPOB 14089, Houston Tx, 77221L A Peters MD
Posted by Doc Pete at 12:51 PM 0 comments
Labels: AMIE, Bibleboost, cytokine dysfuncion, Disease cure, Interleukins
This blog was created to share the information that is fractionated now into separate factions. The Inflammatory Chain brings the parts into a whole that can be understood from conception unto death.
Thursday, January 3, 2008
Investigations into Mitochondrial and Respiratory Chain Dysfunction
In our zeal to deal with the tripartate nature of healing of our patients most recently from Beaumont's and Houston's St. Elizatbeth's Hospitals, VA, Methodist, St. Lukes, Citizen's General, Doctor's Airline , Southwest Memorial, Ross Avenue Medical in Dallas, and Riverside in Houston, we are never amazed at what new things God reveals through the internet.This information is meaningless unless assimilated into a logistical intelligent, retrieval system to be compared to other data that initially may not seem to be related. This has occurred with AMIE. A model was necessary at first and the abbreviation then dialectic query based artificially intelligent system flowed from it allowing a perpetuation of humility with new things discovered.The newest "discovery" of sorts relating all disease to an inflammatory paradigm was the discovery of 1. cytokine involvement in the conception process 2. cytokine involvement in the in utero process and 3 cytokine involvement in the normal functioning process of homeostasis. These were all predicated on the "absence" of inflammatory (dysfunction) which classically would have been the sign of the nanomolar abnormalities, that brought the dysfunction to our attention. A classic example is the involovement of TNF in Toxic Shock Syndrome, as well as meningococal disease, and the coagulatory , and cardiopulmonary complications of this cytokine when in excess.The reason for this is that in western allopathic medicine we classically perceive inflammation and disease as a bad thing in dolor rubor calor and lack of function but in observing its normal functioning components, it gives us superiority of perspective in preventing disease. The observation of a model of the immunologic sytem or chain gives insight into the possibility of cure of all disease. Without the "model" we have no map to find where we got lost because we did not know where we going in the first place.Well the absolute latest addition to this immunologic paradigm for all disease is a result of the search made today. Mitochondrial dysfunction is related to cytokine chain dysfunction which eventuates in respiratory chain dysfunction. The disease that started all the questions was Minimal Change Nephrotic Syndrome in Adults, its equivalent in kids and its manifestation in neurologic, renal cardiovascular, respiratory and orthopedic pathologies.My struggle is to overcome manifold obstacles to continue this research, so whether you are a boss, individual or patron, please step up to the plate and make donations. We are at the crossroads of greatness. Keep this blogg free and allow us to buy a couple of chickens and about 3 more good people for data input (in each city). A donation of $12oo will give youdomain over any "discovery" in your domain city. There will only be 3 "territorial divisions" from each city who will be awarded exclusivity.I love yaMail checks to C and P ConstructionPOB 14089, Houston Tx, 77221L A Peters MD
Posted by Doc Pete at 12:51 PM 0 comments
Labels: AMIE, Bibleboost, cytokine dysfuncion, Disease cure, Interleukins
Mexigood1 Anchorage
Can you send more pictures of what you all are doing in Alaska?
Show us what is going on in Anchorage. Are you working with Eskimos?
Are they extinct?
Send a comment please
Show us what is going on in Anchorage. Are you working with Eskimos?
Are they extinct?
Send a comment please
Saturday, January 5, 2008
Pacientes del MD de Alonzo Peters y los del centro médico y de los clientes del norte de los expedientes de Kimberly 1-5-8¿
Pacientes del MD de Alonzo Peters y los del centro médico y de los clientes del norte de los expedientes de Kimberly 1-5-8¿
Paciencia como un paciente o cliente?
Al centro médico del norte y a cualquie paciente o cliente incluyendo los miembros de iglesia con quienes he entrado en el contacto o entraré en el contacto con la porción tú con los expedientes de Kimberly' y las producciones y los nuestros ministerios. Gracias por tu paciencia. Está a mis amigos de los pacientes, estudiantes de la escuela de domingo, deudores, familia, enemigos y enemigos que envío este saludo del Año Nuevo. En nombre del Jesucristo de el cual por quién y para las cuales el universo incluyendo este globo terrestre fue hecho. Te saludo en la paz, amor y en alegría.Has exhibido paciencia.
Del libro de James.1 James, un criado de dios y del señor Jesucristo, a las doce tribus que se dispersan al extranjero, saludando. 2 mis hermanos, lo cuentan toda la alegría cuando YE cae en tentaciones de los zambullidores; 3 sabiendo esto, eso el intentar de tu paciencia del worketh de la fe. 4 pero dejar la paciencia tienen su trabajo perfecto, ese YE puede ser perfecto y entero, no queriendo nada.
Siento como el gigante que fue atado. ¡Su tiempo que se levanta! Miro adelante a no querer nada, la actitud que tenía en parte cuando te veía todo como pacientes. Como Peter dijo, la plata y el oro tienen I ningunos pero te doy qué tengo.
Debido al hecho de que algunos de nosotros ahora estén en la familia, después de mucha desesperación y distensión, disfruto. Digo esto en confianza completa de ofrecer a Fidel Castro y a Hugo Chavez el plan de la salvación en español. Creo que han hecho trabajos sin una confesión de la fe mientras que tengo para en una cierta parte dada una confesión de la fe sin trabajos. Esto fue hecha en español. También he pedido que el EL Presidente Chavez se disculpa en sus referencias de fabricación del diablo. Esto fue hecha en un próximo tú producción del tubo. También quisiera conseguir enojado en las traiciones, mentiras, amenazas de muerte, asaltos, pero lo hicieron a él así que lo harán a nosotros.
He encontrado muchos cuadros y vídeos. Vídeos de exámenes físicos médicos. Vídeos de los vídeos musicales de nuestras cartas. Cuadros dentro de las cartas. Vídeos de los viajes del misionario y la interacción con esos pacientes, LPs y cintas de cassette. Con todo nada era tan bueno como la experiencia del amor que has dado. Es solamente el amor de mi Jr. de Alonzo Peters de la hermana Lynn, de la mamá y del padre que puedo compararlo a. Agregaré este el pics y los vídeos a este blog como el tiempo permite.
Desperté esta mañana, no triste que los impuestos son debidos y las ejecuciones de una hipoteca son pendientes con los agentes rogue DEA que aplican la presión. En la colocación de trampas y la mentira incluso a mis miembros de iglesia para obtener declaraciones juradas, soy todavía alegre de lo que hemos hecho en una tan breve hora en estos el último de épocas. ¡Te amo! Hemos logrado con qué Abraham, chalet de Pancho, Martin Luther King, Patrice Lamumba, Yamo Kenyata, Moses, Elijah, rey David, E. Franklin Frazier, John F. Kennedy, EL Haj Malik y sobretodo es feliz Jesús. Ellos que nos miran todo de cielo, después de nuestros rezos y confesión de su señoría y de la creencia en substitución de Jesús' en la muerte para nuestros pecados, y su resurrección y vuelta al padre. Elegí intentar comenzar una revolución en mí tales que soy parte de la solución en comparación con el problema. De hecho él está en la mano derecha del padre.
Todo va a estar bien. Se escribe. El babilónico, alcohol de Jezabel no es feliz que su día es casi excesivo y ni una ni otra es su clientela. Ella es de retroceso con el pie y screaming su salida, sufrimos el trauma principal cuando conseguimos golpeados con el pie por el asno. La iglesia virginal el remanente que está aguardando vuelta a Jesús' mientras que hace el ministerio al huérfano, pobres, viuda y el extranjero, puede parecer derrotado pero el enemigo se derrota realmente quién está compitiendo entre sí para más miembros en parcialidad y capital subsecuente solamente para malgastarlo y para tener tomado. “Hay un lechón llevado cada minuto” y para que allí ser una persona que vende cualquier cosa allí debe ser un cliente para comprarlo.
Con todo debemos seguir siendo humildes e intentamos ser YE santo, voluntarioso dibujando lejos de la oscuridad pidiendo llegar a ser santos, y deseando holiness. Me bendicen para esforzarme en la sobriedad para este Holiness. Lo he buscado siempre, pero ahora lo acaricio e intento mantenerlo diario. Soy orgulloso que soy un x-esclavo al alcohol como enfermedad, puta-persiguiendo como ciudadela y que tengo esclavitud literal en mi linaje. Ahora identifico con su alcohol que permitió una actitud de la resistencia.
Todo me conoces. Estoy todavía loco. Sacarlo a soplo de la respiración lento y decir te agradecen Jesus.Part de este júbilo incluso después el cierre de 3 ramas del centro médico del norte, implicadas una batalla contra nuestro sufrimiento en dolor mientras que aquí en la tierra. Diverso ahora miro dolor. Lo miro como bendición. Todavía creo que las minorías, al igual que la ayuda de los periódicos, debajo-se tratan grueso con respecto a dolor. Sin embargo en general practicaría como hice.
La otra parte del júbilo implicó la revelación que la palabra de dios es repleta con referencias a una división o a una separación que permita para las definiciones mutuamente distintas. ¿Cuáles son tú que dice a profesor? Estoy bien alegre tú pedí.
AMIE (educación médica avanzada de la informática) es una invención que ha tomado los contrarios de los experimentos anteriores divulgados en el índice Medicus y en otros diarios naturales del tratamiento y puestos os en un fácilmente recuperable y fácil comparar la base de datos con un énfasis en las enfermedades que implicaban la coagulación, el cáncer, y la locura (comportamiento) en que toda exhibe anormalidades en Interleukins (Cytokines). De génesis 11 en dios del principio crearon el cielo y la tierra. 2 y la tierra estaba sin forma, y vacío; y la oscuridad estaba sobre la cara del profundo. Y el alcohol de dios se movió sobre la cara de las aguas. 3 y dios dijo, dejar allí ser luz: y había luz. 4 y dios vio la luz, de que que era bueno: y dios dividió la luz de la oscuridad. 5 y dios llamó el día ligero, y la oscuridad que él llamó a Noche. Y la tarde y la mañana eran el primer día. Ésta es la información alto significativa y da lo que realizan ésas en la fe, eso que el Cristo creó algo nada 1. con la luz 2. con la división o la separación. Todo lo que hemos hecho con AMIE es escuchar él en decir nos dividir, recuperar y comparar a tiempo así la fabricación de un punto (pixtel si) en un cuadro que escribe después un programa informático. Este cuadro se puede ver posteriormente como (pixtel si) en un cuadro que escribe después un programa informático. Este cuadro se puede ver posteriormente como la guarnición o ser no-congruente con teorías existentes, cadenas, ciclos, síndromes, fórmulas lingüísticas y fórmulas matemáticas. El cuadro resultante es nuestro modelo de la función inmune. Este modelo más las dos bases de datos es nuestra creación, dada a nosotros por EL CREADOR. Su palabra es superior a la ciencia pero hemos creado otro paradigma para mirar datos científicos al igual que Einstein la comparación de energía para importar en su teoría E= MC squared bujía métrica ajustado. El Todopoderoso de dios nos ha bendecido con la maldición de los enemigos permitiendo que poder concentrar en nuestro dios dado la visión de la implicación de cadena inmunológica en todos los procesos fisiológicos incluyendo los que rebelan de la norma y son patofisiológicos (enfermedad). Él ha permitido que a ocasionalmente realicemos cómo él los abrigos del mal de los corazones de los hombres, incluyendo los míos primeros, el suyo bueno en la mejora del hombre. Nuestro empuje primario es subir con las teorías plausibles para la curación de todo el cáncer, coagulación (coágulos que causan ataques del corazón, coágulos del pulmón, y movimiento) hemos asimilado la información que explica lo que se realiza el genoma humano revelado por la explotación minera de datos o la informática. Hemos logrado mucho con nuestras teorías de ahora 25 años ejecutadas en AMIE. Jezabel que vive en Babylon es sí enojado. Su deseo de muerte sobre los pobres se ha puesto en cheque, y hasta Jesús se vuelve allí continuará siendo esfuerzos para dar esperanza a todos que están siendo rechazadas por los hospitales y cuida oficinas a través de la nación. Para esto te aplauden. Debido a tus rezos y ayuda hay esperanza de todos que sean dichas por sus doctores que no hay “nada que podemos hacer”. Te bendicen en el establecimiento de la semilla para la ayuda de la posteridad. Se ha echado el dado y nuestra juventud llevará la bandera manchada sangre. Consiste en la inmersión y el dunked en sangre de Jesús' que demandamos la victoria. Es necesario ahora hacer un bautismo cada día en su agua viva para que nuestra caminata no se deslice otra vez. Rogar para nuestra sinceridad y salvación del enemigo en la carne. Guerreamos no… ..... ese nosotros guerreamos no contra esta carne.
Los agentes rogue han reconocido nuestra invención como significativa. Incluso han intentado imitar este método en su análisis de mi nuestra información de la oficina y de su actividad. Han utilizado a las mentiras, a las cartas alteradas, a las opiniones de la gente y a pacientes que fueron separados (visita rechazada) para cerrar el centro médico del norte y para influenciar al tablero de Tejas de examinadores médicos mientras que utilizaban la técnica de Willie Lynch. Esto estaba además de la confianza en su avaricia en un intento por traicionar nuestra visión de un centro de diagnóstico Médico-Dental dependiente no gubernamental y por de la gente al igual que AL NORTE EL CENTRO MÉDICO. Pregunto que cada uno de ti viene al ensayo apoyarme el 29 de enero. Te mantendremos fijado.
Hacia esta visión que se vuelve pedimos tus rezos sobre todo. Al igual que la Phoenix mítica, Horus mítico o como el real en la realidad Jesús en la resurrección que también deseamos de crear el empleo. Con la creación del capital puede haber una realización de la visión del empleo esto será hecho inicialmente en la bomba de gas en un concepto de la estación de gasolina con la vuelta del servicio completo. Esto será un esfuerzo inicial para substituir el capital en nuestras comunidades generadas de ventas de otras cosas incluyendo los favores crack y sexuales forzados sobre en nosotros por la Guerra en las Drogas.
Escribir los cheques a: C y construcción de P
y enviar eso y cualquier tarjeta del regalo o del gas a:
POB 14089,
Houston Tx. 77221
713-882-7209
pete4doc@hotmail.com
You all know me. I am still crazy. Take a breath blow it out slow and say thank you Jesus.Part of this rejoicing even after closing 3 branches of the North Medical Center, involved a battle against our suffering in pain while here on earth. I look at pain differently now. I look at it as a blessing. I still believe that Minorities, as do the newspapers support, are grossly under-treated with respect to pain. I would still for the most part practice as I did.
The other part of the rejoicing involved the revelation that the Word of God is replete with references to a division or separation that allows for mutually distinct definitions. What are you saying teacher? Well I am glad you asked.
AMIE (Advanced Medical Informatics Education) is an invention that has taken the opposites of previous experiments reported in the Index Medicus and in other natural treatment journals and put them in an easily retrievable and easy to compare data-base with an emphasis on diseases involving clotting, cancer, and craziness (behavior) in that all display abnormalities in Interleukins (Cytokines).From Genesis 11 In the beginning God created the heaven and the earth. 2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters. 3 And God said, Let there be light: and there was light. 4 And God saw the light, that it was good: and God divided the light from the darkness. 5 And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day.This is highly significant information and gives what those in faith realize, that THE Christ created something from nothing 1. with light 2. with division or separating.
All we have done with AMIE is to listen to Him in telling us to divide, retrieve and compare in time thus making a point (pixtel if you will) in a picture after having written a software program. This picture can subsequently be viewed as fitting or being non-congruent with existing theories, chains, cycles, syndromes, linguistic formulas and mathematical formulas. The resultant picture is our Model of Immune function. This Model plus the two data bases is our creation, given to us by THE CREATOR. His Word is superior to science but we have created another paradigm to look at scientific data as did Einstein equating energy to matter in his theory E= MC squared .God almighty has blessed us with the enemies curse by allowing us to be able to concentrate on our God given vision of Immunologic Chain involvement in all physiologic processes including those that rebel from the norm and are pathophysiologic ( disease ). He has allowed us to at times to realize how He coverts from the evil of men’s hearts, including mine foremost, His Good in betterment of man. Our primary thrust is to come up with plausible theories for the cure of all cancer, coagulation (clots causing heart attacks, lung clots, and stroke) We have assimilated the information that explains what the Human Genome performs revealed by data mining or Informatics.
We have accomplished much with our now 25 year old theories implemented in AMIE. Yes the Jezebel who lives in Babylon is mad. Her death wish upon the poor has been put in check, and until Jesus comes back there will continue to be efforts to give hope to all that are being turned down by hospitals and doctors offices across the nation. For this you are applauded. Because of your prayers and support there is hope for all who are told by their doctors that there is “nothing that we can do”. You are blessed in having planted the seed for help of posterity. The die has been cast and our youth will carry the blood stained banner. It is in being dipped and dunked in Jesus’ blood that we claim victory. Now it is necessary to do a baptism each day in His living water for our walk to not slip again.Pray for our sincerity and salvation of the enemy in the flesh. We war not … ….. that we war not against this flesh.
The rogue agents have acknowledged our invention as significant. They have even tried to imitate this method in their analysis of my our office information and its activity. They have used lies, altered charts, people’s opinions and patients who were separated (visit disallowed) to close North Medical Center and influence the Texas Board of Medical Examiners while utilizing Willie Lynch technique. This was in addition to relying on their greed in an attempt to betray our vision of a non-government dependent Medical-Dental Diagnostic Center of and by the people as was NORTH MEDICAL CENTER. I ask that each of you come to the trial to support me on Jan 29th . We will keep you posted.
Towards this vision coming back we ask for your prayers first and foremost. As did the mythical Phoenix, mythical Horus or as the actual in reality Jesus in the resurrection we also desire to create employment. With the creation of capital there can be a realization of the vision of employment will this will initially be done at the gas pump in a service-station concept with full service returning. This will be an initial effort to replace capital in our communities generated from sales of other things including crack and sexual favors forced upon on us by the War on Drugs.
Write checks to: C and P Construction
and send that and any gift or gas cards to:
POB 14089,
Houston Tx. 77221
713-882-7209
pete4doc@hotmail.com
Paciencia como un paciente o cliente?
Al centro médico del norte y a cualquie paciente o cliente incluyendo los miembros de iglesia con quienes he entrado en el contacto o entraré en el contacto con la porción tú con los expedientes de Kimberly' y las producciones y los nuestros ministerios. Gracias por tu paciencia. Está a mis amigos de los pacientes, estudiantes de la escuela de domingo, deudores, familia, enemigos y enemigos que envío este saludo del Año Nuevo. En nombre del Jesucristo de el cual por quién y para las cuales el universo incluyendo este globo terrestre fue hecho. Te saludo en la paz, amor y en alegría.Has exhibido paciencia.
Del libro de James.1 James, un criado de dios y del señor Jesucristo, a las doce tribus que se dispersan al extranjero, saludando. 2 mis hermanos, lo cuentan toda la alegría cuando YE cae en tentaciones de los zambullidores; 3 sabiendo esto, eso el intentar de tu paciencia del worketh de la fe. 4 pero dejar la paciencia tienen su trabajo perfecto, ese YE puede ser perfecto y entero, no queriendo nada.
Siento como el gigante que fue atado. ¡Su tiempo que se levanta! Miro adelante a no querer nada, la actitud que tenía en parte cuando te veía todo como pacientes. Como Peter dijo, la plata y el oro tienen I ningunos pero te doy qué tengo.
Debido al hecho de que algunos de nosotros ahora estén en la familia, después de mucha desesperación y distensión, disfruto. Digo esto en confianza completa de ofrecer a Fidel Castro y a Hugo Chavez el plan de la salvación en español. Creo que han hecho trabajos sin una confesión de la fe mientras que tengo para en una cierta parte dada una confesión de la fe sin trabajos. Esto fue hecha en español. También he pedido que el EL Presidente Chavez se disculpa en sus referencias de fabricación del diablo. Esto fue hecha en un próximo tú producción del tubo. También quisiera conseguir enojado en las traiciones, mentiras, amenazas de muerte, asaltos, pero lo hicieron a él así que lo harán a nosotros.
He encontrado muchos cuadros y vídeos. Vídeos de exámenes físicos médicos. Vídeos de los vídeos musicales de nuestras cartas. Cuadros dentro de las cartas. Vídeos de los viajes del misionario y la interacción con esos pacientes, LPs y cintas de cassette. Con todo nada era tan bueno como la experiencia del amor que has dado. Es solamente el amor de mi Jr. de Alonzo Peters de la hermana Lynn, de la mamá y del padre que puedo compararlo a. Agregaré este el pics y los vídeos a este blog como el tiempo permite.
Desperté esta mañana, no triste que los impuestos son debidos y las ejecuciones de una hipoteca son pendientes con los agentes rogue DEA que aplican la presión. En la colocación de trampas y la mentira incluso a mis miembros de iglesia para obtener declaraciones juradas, soy todavía alegre de lo que hemos hecho en una tan breve hora en estos el último de épocas. ¡Te amo! Hemos logrado con qué Abraham, chalet de Pancho, Martin Luther King, Patrice Lamumba, Yamo Kenyata, Moses, Elijah, rey David, E. Franklin Frazier, John F. Kennedy, EL Haj Malik y sobretodo es feliz Jesús. Ellos que nos miran todo de cielo, después de nuestros rezos y confesión de su señoría y de la creencia en substitución de Jesús' en la muerte para nuestros pecados, y su resurrección y vuelta al padre. Elegí intentar comenzar una revolución en mí tales que soy parte de la solución en comparación con el problema. De hecho él está en la mano derecha del padre.
Todo va a estar bien. Se escribe. El babilónico, alcohol de Jezabel no es feliz que su día es casi excesivo y ni una ni otra es su clientela. Ella es de retroceso con el pie y screaming su salida, sufrimos el trauma principal cuando conseguimos golpeados con el pie por el asno. La iglesia virginal el remanente que está aguardando vuelta a Jesús' mientras que hace el ministerio al huérfano, pobres, viuda y el extranjero, puede parecer derrotado pero el enemigo se derrota realmente quién está compitiendo entre sí para más miembros en parcialidad y capital subsecuente solamente para malgastarlo y para tener tomado. “Hay un lechón llevado cada minuto” y para que allí ser una persona que vende cualquier cosa allí debe ser un cliente para comprarlo.
Con todo debemos seguir siendo humildes e intentamos ser YE santo, voluntarioso dibujando lejos de la oscuridad pidiendo llegar a ser santos, y deseando holiness. Me bendicen para esforzarme en la sobriedad para este Holiness. Lo he buscado siempre, pero ahora lo acaricio e intento mantenerlo diario. Soy orgulloso que soy un x-esclavo al alcohol como enfermedad, puta-persiguiendo como ciudadela y que tengo esclavitud literal en mi linaje. Ahora identifico con su alcohol que permitió una actitud de la resistencia.
Todo me conoces. Estoy todavía loco. Sacarlo a soplo de la respiración lento y decir te agradecen Jesus.Part de este júbilo incluso después el cierre de 3 ramas del centro médico del norte, implicadas una batalla contra nuestro sufrimiento en dolor mientras que aquí en la tierra. Diverso ahora miro dolor. Lo miro como bendición. Todavía creo que las minorías, al igual que la ayuda de los periódicos, debajo-se tratan grueso con respecto a dolor. Sin embargo en general practicaría como hice.
La otra parte del júbilo implicó la revelación que la palabra de dios es repleta con referencias a una división o a una separación que permita para las definiciones mutuamente distintas. ¿Cuáles son tú que dice a profesor? Estoy bien alegre tú pedí.
AMIE (educación médica avanzada de la informática) es una invención que ha tomado los contrarios de los experimentos anteriores divulgados en el índice Medicus y en otros diarios naturales del tratamiento y puestos os en un fácilmente recuperable y fácil comparar la base de datos con un énfasis en las enfermedades que implicaban la coagulación, el cáncer, y la locura (comportamiento) en que toda exhibe anormalidades en Interleukins (Cytokines). De génesis 11 en dios del principio crearon el cielo y la tierra. 2 y la tierra estaba sin forma, y vacío; y la oscuridad estaba sobre la cara del profundo. Y el alcohol de dios se movió sobre la cara de las aguas. 3 y dios dijo, dejar allí ser luz: y había luz. 4 y dios vio la luz, de que que era bueno: y dios dividió la luz de la oscuridad. 5 y dios llamó el día ligero, y la oscuridad que él llamó a Noche. Y la tarde y la mañana eran el primer día. Ésta es la información alto significativa y da lo que realizan ésas en la fe, eso que el Cristo creó algo nada 1. con la luz 2. con la división o la separación. Todo lo que hemos hecho con AMIE es escuchar él en decir nos dividir, recuperar y comparar a tiempo así la fabricación de un punto (pixtel si) en un cuadro que escribe después un programa informático. Este cuadro se puede ver posteriormente como (pixtel si) en un cuadro que escribe después un programa informático. Este cuadro se puede ver posteriormente como la guarnición o ser no-congruente con teorías existentes, cadenas, ciclos, síndromes, fórmulas lingüísticas y fórmulas matemáticas. El cuadro resultante es nuestro modelo de la función inmune. Este modelo más las dos bases de datos es nuestra creación, dada a nosotros por EL CREADOR. Su palabra es superior a la ciencia pero hemos creado otro paradigma para mirar datos científicos al igual que Einstein la comparación de energía para importar en su teoría E= MC squared bujía métrica ajustado. El Todopoderoso de dios nos ha bendecido con la maldición de los enemigos permitiendo que poder concentrar en nuestro dios dado la visión de la implicación de cadena inmunológica en todos los procesos fisiológicos incluyendo los que rebelan de la norma y son patofisiológicos (enfermedad). Él ha permitido que a ocasionalmente realicemos cómo él los abrigos del mal de los corazones de los hombres, incluyendo los míos primeros, el suyo bueno en la mejora del hombre. Nuestro empuje primario es subir con las teorías plausibles para la curación de todo el cáncer, coagulación (coágulos que causan ataques del corazón, coágulos del pulmón, y movimiento) hemos asimilado la información que explica lo que se realiza el genoma humano revelado por la explotación minera de datos o la informática. Hemos logrado mucho con nuestras teorías de ahora 25 años ejecutadas en AMIE. Jezabel que vive en Babylon es sí enojado. Su deseo de muerte sobre los pobres se ha puesto en cheque, y hasta Jesús se vuelve allí continuará siendo esfuerzos para dar esperanza a todos que están siendo rechazadas por los hospitales y cuida oficinas a través de la nación. Para esto te aplauden. Debido a tus rezos y ayuda hay esperanza de todos que sean dichas por sus doctores que no hay “nada que podemos hacer”. Te bendicen en el establecimiento de la semilla para la ayuda de la posteridad. Se ha echado el dado y nuestra juventud llevará la bandera manchada sangre. Consiste en la inmersión y el dunked en sangre de Jesús' que demandamos la victoria. Es necesario ahora hacer un bautismo cada día en su agua viva para que nuestra caminata no se deslice otra vez. Rogar para nuestra sinceridad y salvación del enemigo en la carne. Guerreamos no… ..... ese nosotros guerreamos no contra esta carne.
Los agentes rogue han reconocido nuestra invención como significativa. Incluso han intentado imitar este método en su análisis de mi nuestra información de la oficina y de su actividad. Han utilizado a las mentiras, a las cartas alteradas, a las opiniones de la gente y a pacientes que fueron separados (visita rechazada) para cerrar el centro médico del norte y para influenciar al tablero de Tejas de examinadores médicos mientras que utilizaban la técnica de Willie Lynch. Esto estaba además de la confianza en su avaricia en un intento por traicionar nuestra visión de un centro de diagnóstico Médico-Dental dependiente no gubernamental y por de la gente al igual que AL NORTE EL CENTRO MÉDICO. Pregunto que cada uno de ti viene al ensayo apoyarme el 29 de enero. Te mantendremos fijado.
Hacia esta visión que se vuelve pedimos tus rezos sobre todo. Al igual que la Phoenix mítica, Horus mítico o como el real en la realidad Jesús en la resurrección que también deseamos de crear el empleo. Con la creación del capital puede haber una realización de la visión del empleo esto será hecho inicialmente en la bomba de gas en un concepto de la estación de gasolina con la vuelta del servicio completo. Esto será un esfuerzo inicial para substituir el capital en nuestras comunidades generadas de ventas de otras cosas incluyendo los favores crack y sexuales forzados sobre en nosotros por la Guerra en las Drogas.
Escribir los cheques a: C y construcción de P
y enviar eso y cualquier tarjeta del regalo o del gas a:
POB 14089,
Houston Tx. 77221
713-882-7209
pete4doc@hotmail.com
You all know me. I am still crazy. Take a breath blow it out slow and say thank you Jesus.Part of this rejoicing even after closing 3 branches of the North Medical Center, involved a battle against our suffering in pain while here on earth. I look at pain differently now. I look at it as a blessing. I still believe that Minorities, as do the newspapers support, are grossly under-treated with respect to pain. I would still for the most part practice as I did.
The other part of the rejoicing involved the revelation that the Word of God is replete with references to a division or separation that allows for mutually distinct definitions. What are you saying teacher? Well I am glad you asked.
AMIE (Advanced Medical Informatics Education) is an invention that has taken the opposites of previous experiments reported in the Index Medicus and in other natural treatment journals and put them in an easily retrievable and easy to compare data-base with an emphasis on diseases involving clotting, cancer, and craziness (behavior) in that all display abnormalities in Interleukins (Cytokines).From Genesis 11 In the beginning God created the heaven and the earth. 2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters. 3 And God said, Let there be light: and there was light. 4 And God saw the light, that it was good: and God divided the light from the darkness. 5 And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day.This is highly significant information and gives what those in faith realize, that THE Christ created something from nothing 1. with light 2. with division or separating.
All we have done with AMIE is to listen to Him in telling us to divide, retrieve and compare in time thus making a point (pixtel if you will) in a picture after having written a software program. This picture can subsequently be viewed as fitting or being non-congruent with existing theories, chains, cycles, syndromes, linguistic formulas and mathematical formulas. The resultant picture is our Model of Immune function. This Model plus the two data bases is our creation, given to us by THE CREATOR. His Word is superior to science but we have created another paradigm to look at scientific data as did Einstein equating energy to matter in his theory E= MC squared .God almighty has blessed us with the enemies curse by allowing us to be able to concentrate on our God given vision of Immunologic Chain involvement in all physiologic processes including those that rebel from the norm and are pathophysiologic ( disease ). He has allowed us to at times to realize how He coverts from the evil of men’s hearts, including mine foremost, His Good in betterment of man. Our primary thrust is to come up with plausible theories for the cure of all cancer, coagulation (clots causing heart attacks, lung clots, and stroke) We have assimilated the information that explains what the Human Genome performs revealed by data mining or Informatics.
We have accomplished much with our now 25 year old theories implemented in AMIE. Yes the Jezebel who lives in Babylon is mad. Her death wish upon the poor has been put in check, and until Jesus comes back there will continue to be efforts to give hope to all that are being turned down by hospitals and doctors offices across the nation. For this you are applauded. Because of your prayers and support there is hope for all who are told by their doctors that there is “nothing that we can do”. You are blessed in having planted the seed for help of posterity. The die has been cast and our youth will carry the blood stained banner. It is in being dipped and dunked in Jesus’ blood that we claim victory. Now it is necessary to do a baptism each day in His living water for our walk to not slip again.Pray for our sincerity and salvation of the enemy in the flesh. We war not … ….. that we war not against this flesh.
The rogue agents have acknowledged our invention as significant. They have even tried to imitate this method in their analysis of my our office information and its activity. They have used lies, altered charts, people’s opinions and patients who were separated (visit disallowed) to close North Medical Center and influence the Texas Board of Medical Examiners while utilizing Willie Lynch technique. This was in addition to relying on their greed in an attempt to betray our vision of a non-government dependent Medical-Dental Diagnostic Center of and by the people as was NORTH MEDICAL CENTER. I ask that each of you come to the trial to support me on Jan 29th . We will keep you posted.
Towards this vision coming back we ask for your prayers first and foremost. As did the mythical Phoenix, mythical Horus or as the actual in reality Jesus in the resurrection we also desire to create employment. With the creation of capital there can be a realization of the vision of employment will this will initially be done at the gas pump in a service-station concept with full service returning. This will be an initial effort to replace capital in our communities generated from sales of other things including crack and sexual favors forced upon on us by the War on Drugs.
Write checks to: C and P Construction
and send that and any gift or gas cards to:
POB 14089,
Houston Tx. 77221
713-882-7209
pete4doc@hotmail.com
Alonzo Peters MD, patients, clients of Kimberly Records and Productions
Alonzo Peters' MD Patients and Those of North Medical Center and clients of Kimberly Records 1-5-8
Patience as a patient or client ?
To North Medical Center and to any patient or client including church members that I have come into contact with or will come into contact with serving you with Kimberly Records’ and Productions and our ministries. Thank you for your patience. It is to my patients friends, Sunday School students, debtors, family, enemies and haters that I send this New Year greeting. In the name of Jesus Christ of whom by whom and for whom the universe including this terrestrial globe was made. I greet you in peace, love and in joy.
You have displayed patience.
From the book of James.
1 James, a servant of God and of the Lord Jesus Christ, to the twelve tribes which are scattered abroad, greeting. 2 My brethren, count it all joy when ye fall into divers temptations; 3 Knowing this, that the trying of your faith worketh patience. 4 But let patience have her perfect work, that ye may be perfect and entire, wanting nothing.
I feel like the giant that was tied down. Its getting up time! I look forward to wanting nothing, the attitude that I had in part when I was seeing you all as patients. As Peter said, silver and gold have I none but I give you what I have.
Due to the fact that some of us are now in the family, after much desperation and strife, I rejoice. I say this in full confidence of having offered Fidel Castro and Hugo Chavez the plan of salvation in Spanish. I believe they have done works without a confession of faith whereas I have for in some part given a confession of faith without works. This was done in Spanish. I have also requested that El Presidente Chavez apologize in his making devil references. This was done in an upcoming You Tube production. I would also like to get mad at betrayals, lies, death threats, assaults, but they did it to Him so they will do it to us.
I have found many pictures and videos. Videos of medical physical exams. Videos of music Videos of our charts. Pictures within the charts. Videos of missionary trips and the interaction with those patients, LPs and cassette tapes. Yet nothing was as good as the experience of love that you have given. It is only the love of my sister Lynn , Mom and father Alonzo Peters Jr. that I can compare it to. I will add these pics and videos to this blog as time allows.
I woke up this morning, not sad that taxes are due and foreclosures are pending with rogue agents DEA applying pressure. In laying traps and lying to even my church members to obtain affidavits, I am still joyful of what we have done in such a brief time in these last of times. I love you! We have accomplished what Abraham , Pancho Villa, Martin Luther King , Patrice Lamumba, Yamo Kenyata, Moses, Elijah, King David, E. Franklin Frazier, John F. Kennedy, El Haj Malik and most of all Jesus is happy with. They all looking at us from heaven, after our prayers and confession of His Lordship and of belief in Jesus’ substitution in death for our sins, and His resurrection and return to the Father. I chose to try to begin a revolution in me such that I am part of the solution as opposed to the problem. In fact he is at the right hand of the Father .
Everything is going to be alright. It is written.The Babylonian, Jezebel spirit is not happy that her day is nearly over and neither is her clientele. She is kicking and screaming her way out, We suffered head trauma when we got kicked by the ass . The remnant maiden Church who is awaiting Jesus’ return while doing ministry to the orphan, poor, widow and stranger, may look defeated but actually the enemy is defeated who is competing with each other for more members in partiality and subsequent capital only to squander and have it taken. “There is a sucker born every minute” and in order for there to be a person selling anything there must be a customer to buy it.
Yet we must remain humble and attempt to be ye holy, willfully drawing away from the darkness by asking to become holy, and by desiring holiness. I am blessed to strive in sobriety for this Holiness. I have always sought it, but now I cherish it and attempt to maintain it daily. I am proud that I am an x-slave to alcohol as a disease, whore-chasing as a stronghold and that I have literal slavery in my lineage. I identify now with His Spirit who allowed an attitude of resilience.
You all know me. I am still crazy. Take a breath blow it out slow and say thank you Jesus.Part of this rejoicing even after closing 3 branches of the North Medical Center, involved a battle against our suffering in pain while here on earth. I look at pain differently now. I look at it as a blessing. I still believe that Minorities, as do the newspapers support, are grossly under-treated with respect to pain. I would still for the most part practice as I did.
The other part of the rejoicing involved the revelation that the Word of God is replete with references to a division or separation that allows for mutually distinct definitions. What are you saying teacher? Well I am glad you asked.
AMIE (Advanced Medical Informatics Education) is an invention that has taken the opposites of previous experiments reported in the Index Medicus and in other natural treatment journals and put them in an easily retrievable and easy to compare data-base with an emphasis on diseases involving clotting, cancer, and craziness (behavior) in that all display abnormalities in Interleukins (Cytokines).From Genesis 11 In the beginning God created the heaven and the earth. 2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters. 3 And God said, Let there be light: and there was light. 4 And God saw the light, that it was good: and God divided the light from the darkness. 5 And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day.This is highly significant information and gives what those in faith realize, that THE Christ created something from nothing 1. with light 2. with division or separating. All we have done with AMIE is to listen to Him in telling us to divide, retrieve and compare in time thus making a point (pixtel if you will) in a picture after having written a software program. This picture can subsequently be viewed as fitting or being non-congruent with existing theories, chains, cycles, syndromes, linguistic formulas and mathematical formulas. The resultant picture is our Model of Immune function. This Model plus the two data bases is our creation, given to us by THE CREATOR. His Word is superior to science but we have created another paradigm to look at scientific data as did Einstein equating energy to matter in his theory E= MC squared .God almighty has blessed us with the enemies curse by allowing us to be able to concentrate on our God given vision of Immunologic Chain involvement in all physiologic processes including those that rebel from the norm and are pathophysiologic ( disease ). He has allowed us to at times to realize how He coverts from the evil of men’s hearts, including mine foremost, His Good in betterment of man. Our primary thrust is to come up with plausible theories for the cure of all cancer, coagulation (clots causing heart attacks, lung clots, and stroke) We have assimilated the information that explains what the Human Genome performs revealed by data mining or Informatics. We have accomplished much with our now 25 year old theories implemented in AMIE. Yes the Jezebel who lives in Babylon is mad. Her death wish upon the poor has been put in check, and until Jesus comes back there will continue to be efforts to give hope to all that are being turned down by hospitals and doctors offices across the nation. For this you are applauded. Because of your prayers and support there is hope for all who are told by their doctors that there is “nothing that we can do”. You are blessed in having planted the seed for help of posterity. The die has been cast and our youth will carry the blood stained banner. It is in being dipped and dunked in Jesus’ blood that we claim victory. Now it is necessary to do a baptism each day in His living water for our walk to not slip again.Pray for our sincerity and salvation of the enemy in the flesh. We war not … ….. that we war not against this flesh.
The rogue agents have acknowledged our invention as significant. They have even tried to imitate this method in their analysis of my our office information and its activity. They have used lies, altered charts, people’s opinions and patients who were separated (visit disallowed) to close North Medical Center and influence the Texas Board of Medical Examiners while utilizing Willie Lynch technique. This was in addition to relying on their greed in an attempt to betray our vision of a non-government dependent Medical-Dental Diagnostic Center of and by the people as was NORTH MEDICAL CENTER. I ask that each of you come to the trial to support me on Jan 29th . We will keep you posted.
Towards this vision coming back we ask for your prayers first and foremost. As did the mythical Phoenix, mythical Horus or as the actual in reality Jesus in the resurrection we also desire to create employment. With the creation of capital there can be a realization of the vision of employment will this will initially be done at the gas pump in a service-station concept with full service returning. This will be an initial effort to replace capital in our communities generated from sales of other things including crack and sexual favors forced upon on us by the War on Drugs.
Write checks to: C and P Construction
and send that and any gift or gas cards to:
POB 14089,
Houston Tx. 77221
713-882-7209
pete4doc@hotmail.com
Patience as a patient or client ?
To North Medical Center and to any patient or client including church members that I have come into contact with or will come into contact with serving you with Kimberly Records’ and Productions and our ministries. Thank you for your patience. It is to my patients friends, Sunday School students, debtors, family, enemies and haters that I send this New Year greeting. In the name of Jesus Christ of whom by whom and for whom the universe including this terrestrial globe was made. I greet you in peace, love and in joy.
You have displayed patience.
From the book of James.
1 James, a servant of God and of the Lord Jesus Christ, to the twelve tribes which are scattered abroad, greeting. 2 My brethren, count it all joy when ye fall into divers temptations; 3 Knowing this, that the trying of your faith worketh patience. 4 But let patience have her perfect work, that ye may be perfect and entire, wanting nothing.
I feel like the giant that was tied down. Its getting up time! I look forward to wanting nothing, the attitude that I had in part when I was seeing you all as patients. As Peter said, silver and gold have I none but I give you what I have.
Due to the fact that some of us are now in the family, after much desperation and strife, I rejoice. I say this in full confidence of having offered Fidel Castro and Hugo Chavez the plan of salvation in Spanish. I believe they have done works without a confession of faith whereas I have for in some part given a confession of faith without works. This was done in Spanish. I have also requested that El Presidente Chavez apologize in his making devil references. This was done in an upcoming You Tube production. I would also like to get mad at betrayals, lies, death threats, assaults, but they did it to Him so they will do it to us.
I have found many pictures and videos. Videos of medical physical exams. Videos of music Videos of our charts. Pictures within the charts. Videos of missionary trips and the interaction with those patients, LPs and cassette tapes. Yet nothing was as good as the experience of love that you have given. It is only the love of my sister Lynn , Mom and father Alonzo Peters Jr. that I can compare it to. I will add these pics and videos to this blog as time allows.
I woke up this morning, not sad that taxes are due and foreclosures are pending with rogue agents DEA applying pressure. In laying traps and lying to even my church members to obtain affidavits, I am still joyful of what we have done in such a brief time in these last of times. I love you! We have accomplished what Abraham , Pancho Villa, Martin Luther King , Patrice Lamumba, Yamo Kenyata, Moses, Elijah, King David, E. Franklin Frazier, John F. Kennedy, El Haj Malik and most of all Jesus is happy with. They all looking at us from heaven, after our prayers and confession of His Lordship and of belief in Jesus’ substitution in death for our sins, and His resurrection and return to the Father. I chose to try to begin a revolution in me such that I am part of the solution as opposed to the problem. In fact he is at the right hand of the Father .
Everything is going to be alright. It is written.The Babylonian, Jezebel spirit is not happy that her day is nearly over and neither is her clientele. She is kicking and screaming her way out, We suffered head trauma when we got kicked by the ass . The remnant maiden Church who is awaiting Jesus’ return while doing ministry to the orphan, poor, widow and stranger, may look defeated but actually the enemy is defeated who is competing with each other for more members in partiality and subsequent capital only to squander and have it taken. “There is a sucker born every minute” and in order for there to be a person selling anything there must be a customer to buy it.
Yet we must remain humble and attempt to be ye holy, willfully drawing away from the darkness by asking to become holy, and by desiring holiness. I am blessed to strive in sobriety for this Holiness. I have always sought it, but now I cherish it and attempt to maintain it daily. I am proud that I am an x-slave to alcohol as a disease, whore-chasing as a stronghold and that I have literal slavery in my lineage. I identify now with His Spirit who allowed an attitude of resilience.
You all know me. I am still crazy. Take a breath blow it out slow and say thank you Jesus.Part of this rejoicing even after closing 3 branches of the North Medical Center, involved a battle against our suffering in pain while here on earth. I look at pain differently now. I look at it as a blessing. I still believe that Minorities, as do the newspapers support, are grossly under-treated with respect to pain. I would still for the most part practice as I did.
The other part of the rejoicing involved the revelation that the Word of God is replete with references to a division or separation that allows for mutually distinct definitions. What are you saying teacher? Well I am glad you asked.
AMIE (Advanced Medical Informatics Education) is an invention that has taken the opposites of previous experiments reported in the Index Medicus and in other natural treatment journals and put them in an easily retrievable and easy to compare data-base with an emphasis on diseases involving clotting, cancer, and craziness (behavior) in that all display abnormalities in Interleukins (Cytokines).From Genesis 11 In the beginning God created the heaven and the earth. 2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters. 3 And God said, Let there be light: and there was light. 4 And God saw the light, that it was good: and God divided the light from the darkness. 5 And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day.This is highly significant information and gives what those in faith realize, that THE Christ created something from nothing 1. with light 2. with division or separating. All we have done with AMIE is to listen to Him in telling us to divide, retrieve and compare in time thus making a point (pixtel if you will) in a picture after having written a software program. This picture can subsequently be viewed as fitting or being non-congruent with existing theories, chains, cycles, syndromes, linguistic formulas and mathematical formulas. The resultant picture is our Model of Immune function. This Model plus the two data bases is our creation, given to us by THE CREATOR. His Word is superior to science but we have created another paradigm to look at scientific data as did Einstein equating energy to matter in his theory E= MC squared .God almighty has blessed us with the enemies curse by allowing us to be able to concentrate on our God given vision of Immunologic Chain involvement in all physiologic processes including those that rebel from the norm and are pathophysiologic ( disease ). He has allowed us to at times to realize how He coverts from the evil of men’s hearts, including mine foremost, His Good in betterment of man. Our primary thrust is to come up with plausible theories for the cure of all cancer, coagulation (clots causing heart attacks, lung clots, and stroke) We have assimilated the information that explains what the Human Genome performs revealed by data mining or Informatics. We have accomplished much with our now 25 year old theories implemented in AMIE. Yes the Jezebel who lives in Babylon is mad. Her death wish upon the poor has been put in check, and until Jesus comes back there will continue to be efforts to give hope to all that are being turned down by hospitals and doctors offices across the nation. For this you are applauded. Because of your prayers and support there is hope for all who are told by their doctors that there is “nothing that we can do”. You are blessed in having planted the seed for help of posterity. The die has been cast and our youth will carry the blood stained banner. It is in being dipped and dunked in Jesus’ blood that we claim victory. Now it is necessary to do a baptism each day in His living water for our walk to not slip again.Pray for our sincerity and salvation of the enemy in the flesh. We war not … ….. that we war not against this flesh.
The rogue agents have acknowledged our invention as significant. They have even tried to imitate this method in their analysis of my our office information and its activity. They have used lies, altered charts, people’s opinions and patients who were separated (visit disallowed) to close North Medical Center and influence the Texas Board of Medical Examiners while utilizing Willie Lynch technique. This was in addition to relying on their greed in an attempt to betray our vision of a non-government dependent Medical-Dental Diagnostic Center of and by the people as was NORTH MEDICAL CENTER. I ask that each of you come to the trial to support me on Jan 29th . We will keep you posted.
Towards this vision coming back we ask for your prayers first and foremost. As did the mythical Phoenix, mythical Horus or as the actual in reality Jesus in the resurrection we also desire to create employment. With the creation of capital there can be a realization of the vision of employment will this will initially be done at the gas pump in a service-station concept with full service returning. This will be an initial effort to replace capital in our communities generated from sales of other things including crack and sexual favors forced upon on us by the War on Drugs.
Write checks to: C and P Construction
and send that and any gift or gas cards to:
POB 14089,
Houston Tx. 77221
713-882-7209
pete4doc@hotmail.com